Haplogroup G2c (Y-DNA)
From Ask in Wiki
In human genetics, Haplogroup G2c (formerly G5) is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation.<ref name="pmid16400607">Template:Cite journal</ref> It is a branch of Haplogroup G, which in turn is defined by the presence of the M201 mutation<ref>M201 mutation</ref>.
G2c is a major Y chromosome haplogroup, and yet unique: It is extremely rare, almost completely specific to a single ethnic group in Europe, Ashkenazi Jews, and shows strong evidence of a very recent settlement in Europe. It has not proven to have been found in any other region until now except in a single Turk from Kars Province in Turkey in the border with Armenia, an Uzbek from Uzbekistan, a single Pashtun from the area of Pakistan bordering Afghanistan in the Hindu Kush range, and a single Burusho from the Hunza Valley in the Karakorum Range in Kashmir. These groups, the Ashkenazi Jews from Poland-Lithuania and Germany, a Turk from the northeastern region of Turkey that was the historic heartland of Medieval Armenia, and on the other hand the Uzbeks, Pashtuns, and Burusho, are very widely separated geographically, and have not been known to have had hardly any contact with each other in their respective histories.
G2c presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G2c has none of these. It is most common by far in a region where it arrived very recently, but exceedingly rare in other region including it likely area of origin. The distribution of G2c is incredibly sparse and dispersed, with almost no G2c haplotypes found in very large intervening regions. This pattern is unique among Y haplogroups.
Phylogenetic position
Extensive SNP testing by the Haplogroup G SNP project found that G2c is an independent branch of haplogroup G characterized by only one SNP, M377. A forthcoming study by the Y Chromosome Consortium at the University of Arizona found that within haplogroup G, G2c and G2 share a new SNP, P387, which is not found in the other well-attested branch of G, haplogroup G1. As a result, it will be proposed that Haplogroup G5 be renamed "G2c".
Haplogroup characteristics
Distinguishing Y-STR alleles
For the full listing of all the G2c Y-STR modal haplotype values, see the entry:
HRGEN in ySearch.org
All G2c samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2c.
| Y-STR | Allele range | Modals |
|---|---|---|
| DYS393 | 12-13 | 13 |
| DYS390 | 23-24 | 23 |
| DYS19 | 15-17 | 15 17 |
| DYS391 | 10-11 | 10 11 |
| DYS385* | 13,15 13,16 14,16 | 13,16 |
| DYS426 | 11 | |
| DYS388 | 12 | |
| DYS439 | 11-12 | 11 |
| DYS392 | 11 | |
| DYS389 | 13,29 13,30 13,31 14,31 14,32 14,33 15,33 | 13,30 14,31 14,32 |
| DYS459 | 8,9 | |
| DYS464 | 13,13,14,15 13,13,15,15 13,14,14,15 13,14,15,15 | 13,14,15,15 |
| DYS607 | 15-17 | 16 |
| DYS395S1a | 16,16 | |
| DYS425 | null | |
| DYS413 | 21,22 | |
| DYS436 | 11 | |
| DYS481 | 19 | |
| DYS461 | 12 |
* In haplogroup G2c, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.
Primer sequence
| SNP name | gene | gene location | Y position | |
|---|---|---|---|---|
| M377 | DDX3Y | intron 10 | 15,536,827 | |
| Primer (5'→3')<ref name="pmid16400607"/> | ||||
| position (bp) | SNP | forward | reverse | length (bp) |
| 40 | A→T | tatgcatttgttgagtatatgtc | gttctgaatgaaagttcaaacg | 326 |
Distribution
Ashkenazi Jews
A cluster of closely related Ashkenazi Jews represent virtually all confirmed G2c persons worldwide, both from private testing, and from academic studies. Of 211 known European G2cs, 8 are known to have non-Jewish patrilineal ancestors. G2c makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33).<ref name="pmid14740294">Template:Cite journal</ref>In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes haplotypes 4 and 6-15 are G2c, 2,3,5 are G1, and the haplogroup of the first listed is unclear. A much smaller group of Ashkenazi Jews however are in haplogroup G1, so not all GxG2 Ashkenazi Jews in the above study would be G2c. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G2cs and 14 Ashkenazi G1s. The ratio of G2c:G1 among Ashkenazi Jews is approximately 10:1.
- European G2c comparative haplotype table
- European G2c unique haplotypes
- G2c SMGF.org haplotype search
Eastern Europe
The distribution of G2c in Eastern Europe very closely reflects the 16th and 17th century settlement patterns of Ashkenazi Jews in the Polish-Lithuanian Commonwealth:
Image:Map of the partition of the Kingdom of Poland and the Grand Duchy of Lithuania from 1799.jpg Map of the partition of the Kingdom of Poland and the Grand Duchy of Lithuania from 1799. The full extent of the Polish-Lithuanian Commonwealth before partition in 1765 closely matches the distribution of G2c in Eastern Europe. The areas in this map colored yellow were taken by Prussia, those colored green were taken by Austria, and those colored pink by Russia. |
Western Germany
G2c is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto. Jews were expelled in 1670 from Vienna and the Archduchy of Austria.<ref> Template:Cite encyclopedia</ref> After Khmelytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. It isn't clear at this point whether German Jewish G2cs represent an independent settlement, or the result of a migration from Eastern Europe (although there is some evidence for the latter).
Southern Italy and Sicily
Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of 211 known European G2cs, there are 4 Sicilians, including 3 members of one family with a tradition of patrilineal descent from 16th century Sicily.
Eastern Anatolia
A confirmed G2c Y-STR haplotype<ref>Template:Cite news</ref> found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) which was found in Eastern Turkey, in the city of Kars, very close to Armenia.<ref name="pmid14586639">Template:Cite journal</ref>
The Hindu Kush and Kashmir (Pakistan)
There are just two other confirmed G2c samples that have been publicly reported in the academic literature so far, one Pashtun in the Northwest Frontier Provinces of Pakistan (the Hindu Kush Range), and one Burusho in the Hunza Valley in Kashmir. These two G2cs are Y-STR haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages.<ref name="pmid16400607">Template:Cite journal</ref> | Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G2c, making it likely that this single G is G2c as well. <ref name="pmid17047675">Template:Cite journal</ref> The YHRD European forensic database has several haplotypes from Pakistan that are very likely to be G2c, including 1 Burusho (n=94) and 5 Pashtuns (n-93).<ref>Template:Cite web</ref><ref>Template:Cite web</ref>
Hunza
Hunza was an important stop on the Silk Road from the Near East to China. The fertile Hunza Valley was the last resting point before the Khunjerab Pass (el. 4693 m./15397 ft.) which was the highest point on the southern route of the Silk Road from Iran, the Indian Ocean ports of the Makran Coast in Pakistan, to the Kashgar oasis in the Gobi Desert of western China. Among the Burusho South Asian Y haplogroups predominate, but there are some representatives of Central Asian (C3) and East Asian (O3) haplogroups as well.<ref name="pmid16400607"/><ref name="pmid17047675"/>. Sengupta et al. (2006) found the Burushos to be completely lacking in haplogroup G2a which is well-represented among the nearby Kalash and Pashtun populations.<ref name="pmid17047675"/>
Possible Greek G2c haplotype
YHRD has 1 Greek haplotype (n=101) from Athens that may be G2c, and has some values that are relatively close to Ashkenazi Jewish G2c haplotypes.<ref>Template:Cite web</ref>
Likely Uzbek G2c haplotype
One haplotype which has been confirmed to be in Y-DNA Haplogroup G was found in a private study in an Uzbek at 12 Y-STRs has a motif that is close to one of the modal haplotypes for the Ashkenazi Jewish G5 clade, and also matches some Pathan and Burusho haplotypes in YHRD at 7 Y-STR alleles.<ref>Template:Cite web</ref>
Possible Syrian G2c haplotypes
YHRD has 2 Syrian (n=113) haplotypes that are probably G2c based on their similarity to the Turkish, Pathan, and Burusho G2c haplotypes.<ref>Template:Cite web</ref><ref>Template:Cite web</ref>
Possible Iranian G2c haplotype
Nasidze et al (2003)<ref name="pmid14550619">Template:Cite journal</ref> found a single haplotype from Tehran, Iran, haplotype 13 in the following table Nasidze et al. (2003) (Supplementary Data), that has a haplotype motif that is unique to G5. This same haplotype also appears in the YHRD database (n=80), and is very likely to be the same sample.<ref>Template:Cite web</ref> Another study of Iran, Regueiro et. al (2006)<ref name="pmid16770078">Template:Cite journal</ref> tested for M377/G5 (n=150) and found G5 to be absent in their sample, so adding the results of these two studies we can say that the possible occurrence of G5 in Iran is approximately 1 out of 230, and that G5 is only found in north Iran.
Possible Armenian G2c haplotypes
In a study of Armenian Y chromosomes by Weale et al. (2001) (n=741), haplotype 108 in "Haplogroup 2" which consisted of Y haplogroups F*, G, and I,<ref name=YCC> Template:Cite web</ref> has a 6 Y-STR haplotype identical with that of the modal for Ashkenazi Jewish G2c. These two samples were found in one man whose ancestors came from what is now Eastern Turkey, and one from Nagorno-Karabakh. One unpublished sample from a set of Armenians from Crimea (n=69) came from an Armenian whose ancestors came from the area of the Medieval Armenian capital of Ani<ref>Template:Cite book</ref>, and three samples came from Armenians with ancestors from the southern region of Georgia (n=145), the area of Georgia that is very close to Ani. This totals to 6 possible G2c haplotypes out of a total sample of 1288 or 0.5% of Armenians, 5 of whom are from the region surrounding Ani.<ref name=Yepiskoposyan>Template:Cite news</ref> However, there are some G2 haplotypes that appear similar to G2c at these 6 STRs, but not at DYS389, including one from Turkey. It may be that some or all of these Armenian haplotypes are not G2c, but rather G2a, since DYS389 was not tested.<ref> Template:Cite web</ref>
Historical background of the Ani region
In 894 CE, the Bagratid Prince Ashot I was given the title of King of Armenia by the Abbasid Caliphate<ref>Template:Cite book</ref> and briefly established his capital at the ancient Armenian center of Bagaran 40km south of Ani, and then moved it to Shirakavan, 15km northeast of Ani. In 929 the capital was transferred to Kars, 42km west of Ani, and then in 969 to Ani itself.<ref>Template:Cite book</ref><ref>Template:Cite book</ref> Ani in the 10th and 11th centuries had a population as high as 100,000 - 200,000. The city continued to flourish even after the capture of Ani in 1064 by the Seljuks under Alp Arslan, and the subsequent rule by the Kurdish Muslim Shaddadid dynasty from 1072-1199. In 1199 Ani was captured by the forces of Queen Tamar of Georgia and a Georgian vassal kingdom was created which was ruled by the Zakarid dynasty. In 1236, the Mongols captured Ani, killing many of its inhabitants, but afterward it was continued to be ruled by the Georgian Zakarids. After its capture by the Turkic Kara Koyunlu in the 1330s, Ani declined rapidly. The Kara Koyunlu moved their capital to Yerevan in 1446 and by the 18th century Ani had been completely abandoned.<ref> Template:Cite web</ref>
There is no evidence that Ani or the adjacent areas ever had a Jewish population in the Medieval period. <ref>Template:Cite book</ref> There may have been an early presence of Jews in the Kingdom of Armenia in late Hellenistic and Roman times before the conversion of Armenia to Christianity,<ref> Template:Cite web</ref> However, the possible presence of G2c almost exclusively in the region of the Medieval capitals of Armenia, Bagaran, Shirakavan, Kars, and Ani would indicate that, if indeed these haplotypes are G2c, it appeared in Armenia no earlier than 802 CE and no later than the mid-14th century.
Other possible G2c Jewish haplotypes
Two possible G2c Y-STR haplotype samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews<ref>Template:Cite encyclopedia</ref> (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). These also belong to what was termed at the time "Haplogroup 2", (F*,G, and I)<ref name=YCC/> and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G2c. In this study, G2c was found among 3% of Kurdish Jews.<ref name="pmid11573163">Template:Cite journal</ref> However, as with the Armenians, there are some G2 haplotypes that appear similar to G2c at these 6 STRs, but not at DYS389.<ref> Template:Cite web</ref>
Major regions where G2c is not found
There is much evidence as to which regions completely lack G2c. The following studies failed to find any G2c in their respective areas:
- The Caucasus (aside from the above study of Armenians):
- A study of Caucasian Y-STR haplotypes (n=364) by Nasidze et al. (2003), while it did no Y haplogroup testing, found no 9 Y-STR haplotype patterns within the range of variation found in G2c.<ref name="pmid14550619">Template:Cite journal</ref>
- An unpublished survey of Adyghe (n=242) from the North Caucasus.<ref name=Yepiskoposyan/>
- Kurdistan (non-Jews):
- G2c was not found in an unpublished survey of Yezidis (n=202) and Assyrians (n=106) collected in Armenia (these groups are originally from southeast Turkey and Kurdistan),<ref name=Yepiskoposyan/> and Muslim Kurds from Nebel et al. (2003).<ref name="pmid11573163"/>
- Iberia and North Africa:
- A study of Iberian (n=860) and North African Berber (n=75) Y chromosomes by Alonso et al. (2005)<ref name="pmid16094307">Template:Cite journal</ref>
- Jordan, Palestinian Arabs, and Bedouins from the Negev:
- A study of samples from Amman (n=101) and the Dead Sea area (n=45) in Jordan by Flores et al. (2005)<ref name="pmid16142507">Template:Cite journal</ref>
- Palestinian Arabs (n=143) and Negev Bedouin (n=30) from Nebel et al. (2003)
- India
- Sengupta et al. (2006) found no G2c haplotypes in India (n=728) and none in southern Pakistan.<ref name="pmid16400607"/>
- The Persian Gulf and Yemen
- Cadenas et. al. (2007) found no G* and therefore no G2c haplotypes in Qatar (n=72), the United Arab Emirates (n=174), and Yemen (n=62)
Upcoming studies
Other Y chromosome samples taken from an upcoming study of Sephardi and Near Eastern (Mizrahi) Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches the any of the modal haplotypes for G2c, however, all of these samples are being tested for M377/G2c.
The Kurdish and Iraqi Jewish samples from Nebel et al. (2002) are also being tested for M377/G2c by a different group for another study. Y chromosome haplogroup G1 is also found among Jewish populations, but it is likely that some of these samples will turn out to be in haplogroup G2c.
Comparison of regional haplotypes
| Population and Location | n | Status | DYS393 | DYS390 | DYS19 | DYS391 | DYS385 | DYS426 | DYS388 | DYS439 | DYS392 | DYS389 | DYS438 | DYS461 = add 2 to DYSA7.2 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ashkenazi Jews Poland-Lithuania | 300 | confirmed | 12 13 | 22 23 24 | 15 16 | 9 10 11 | 13,15 13,16 14,16 | 11 | 12 | 11 12 | 11 | 13,30 13,31 13,32 13,33 14,31 14,32 14,33 15,33 | 10 | 12 |
| Turkey Kars | 1 | confirmed | 13 | 23 | 16 | 10 | 11 | 12 | 11 | 11 | 13,29 | |||
| Uzbek | 1 | confirmed | 13 | 23 | 16 | 11 | 13,16 | 11 | 12 | 11 | 11 | 13,30</span> | ||
| Pathans | 6 | confirmed | 13 | 23 | 17 | 10 | 11 | 12 | 11 | 11 | 13,30 | 12 | ||
| Burusho Hunza Valley | 1 | confirmed | 13 | 23 | 17 | 11 | 11 | 12 | 11 | 11 | 13,30 | 12 | ||
| Greek Athens | 1 | possible | 13 | 23 | 16 | 11 | 13,16 | 11 | 13,31 | |||||
| Syrians | 2 | possible | 13 | 23 | 16 | 11 | 14,16 14,15 | 11 | 13,30 | |||||
| Iranian Tehran | 1 | possible | 13 | 23 | 17 | 10 | 13,16 | 11 | 13,29 | |||||
| Iraqi Jew | 1 | F*,G,I | 13 | 23 | 15 | 11 | 11 | 12 | 11 | |||||
| Armenians The Ani region Nagorno-Karabakh | 5 | F*,G,I | 13 | 23 | 15 | 10 | 11 | 12 | 11 | |||||
| Kurdish Jews | 3 | F*,G,I | 13 | 23 | 15 | 10 | 11 | 12 | 11 |
Time to the Most Recent Common Ancestor (tMRCA)
The time to the Most Recent Common Ancestor (tMRCA) for European G2c, derived by generating a median-joining network<ref name="pmid10331250">Template:Cite journal</ref> of over 25 haplotypes with 67 Y-STRs, yields a date of 461 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years.<ref>Template:Cite news</ref> The mutation rate used is based on that of family groups with known most recent common ancestors.<ref> Template:Cite web</ref> The date is just before the year 1492, a significant date in European Jewish history, when the Jews of Sicily (at that time ruled by Spain) were expelled or forced to convert. So far, this tMRCA includes all groups of European G2cs, including it seems from preliminary evidence, the Italians.
This late tMRCA date for all of G2c in Europe raises the question of when G2c first entered Europe. If G2c entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically-specific distribution of G2c in Europe combined with the very late tMRCA raises the question of from where G2c could have entered Europe. Also, was the spread of G2c in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G2c, with samples from each region matching some from other regions more closely than ones from the same region.
Possible history
Sicily
The most plausible scenario for the spread of G2c within Europe is an origin among Jews in Sicily, and a spread northward to Germany and the Polish-Lithuanian Commonwealth at the time of the expulsion of the Jews of Sicily in 1492.
It is estimated that Jews made up 6% or more of the population of Sicily in 1492.<ref> Template:Cite web</ref> Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. Thre was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580's. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.<ref> Template:Cite encyclopedia</ref><ref> Template:Cite encyclopedia</ref><ref> Template:Cite web</ref><ref>Template:Cite book</ref>
In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2c in Germany may be due to a later migration from Eastern Europe to Germany starting with the aftermath of Khmelnytsky's Pogrom in Poland in 1648,
Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire<ref> Template:Cite web</ref>. After the Muslim conquest of Sicily in 831-902, large numbers of Jews settled on the island.<ref> Template:Cite journal</ref> In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina. <ref> Template:Cite web</ref> In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there.<ref> Template:Cite web</ref><ref> Template:Cite web</ref><ref> Template:Cite web</ref> This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.
The preliminary conclusions from this evidence is that haplogroup G2c is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2c in Iberia and also so far among Spanish Jews indicates that G2c didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2c. We know that Greek and Mizrahi Jews arrived in Sicily as late as 1149,and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily. This is one way of explaining the very late presence of G2c in Europe, the likely presence of G2c among at least Kurdish Jews, if not other Mizrahi Jews as well.
The East - Uzbekistan, the Pathans, and the Burushos
The presence of G2c in the these areas may be accounted for by several several separate theories, each with their own time scale. It does seem very likely that G2c originated in the Near East, in Anatolia or Syria, and spread both eastward and westward from there.
One often stated idea is of a direct Israelite ancestry for the Pashtuns as a whole. The Israelite origin of all the Pashtuns is contradicted by the ancient sources,<ref>Template:Cite book</ref><ref>Template:Cite book</ref> and also by the Iranian linguistic affiliations of the Pashto language. These stories were disseminated in Medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes, but this would depend on the frequency of G2c among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.
Possible Neolithic spread of G2c
Alexander and the Greco-Bactrian Kingdom
The Silk Road
The rarity of G2c in northeast Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G2c haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G2c based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G2c to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.<ref> Template:Cite web</ref>
A Northern Near Eastern / South Caucasian origin for G2c is much more likely. The Turkish G2c haplotype, and 5 of 6 other almost certain G2c Armenian haplotypes have ancestors from a small region in Kars Province of Turkey near the Medieval capitals of Armenia. The rarity of G2c, which is limited to this small area which only became important after the year 884 is most likely due to G2c arriving in the region after this time.
Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G2c could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora to Italy and then Central and Eastern Europe. If the evidence shows that no Sephardi or Mizrahi Jews have G2c, then an origin with the Khazars of the Caucasus or another associated people who historically converted to Judaism during the Khazar Empire (c. 670-1017) although the particular regions where G2c is found in northeastern Anatolia and Armenia were never part of the Khazar Empire even at its greatest extent but always a part of Armenia.
Further avenues for research
More samples from Italy are very important. Also, deriving a tMRCA for all of European G2c, including Italy is crucial. One would expect that the tMRCA including Italy would be a bit further back than circa 1492, but so far there is no evidence for this. Confirming whether there are other Jewish G2c's that are not European, and then getting the tMRCA with these samples will indicate the immediate source of Ashkenazi Jewish G2c. Confirmation that the Armenian haplotypes are actually G2c is also needed. Then, finding more G2c's in the Kashmir region and calculating a tMRCA, with the Turkish G2c sample and the Jewish G2c's, would indicate the direction of the gene flow.
Famous people in haplogroup G2c
- Newton Minow (b. 1926)
- Former Chairman of the United States Federal Communications Commission (FCC) and Chairman of the Public Broadcasting Service (PBS).
- James Franciscus (1934-1991)
- Leading American film and television actor.
References
<references/>
See also
External links
Sites
- Family Tree DNA Haplogroup G2c Project
- SMGF search for G2c haplotypes
- Haplogroup G2c European haplotype comparison table
- Unique haplotypes for haplogroup G2c in Europe
- Haplogroup G SNP project
- Some Information and Theories on Haplogroup G
Maps
Mailing Lists
- Haplogroup G2c discussion group
- Haplogroup G Yahoo Group
- Rootsweb Haplogroup G Mailing List
- Family Tree DNA's Haplogroup G2c Project
- FamilyTreeDNA's Haplogroup G Project
| Y-most recent common ancestor | ||||||||||||||||||||||
| | | ||||||||||||||||||||||
| A | BR | |||||||||||||||||||||
| B | CR | |||||||||||||||||||||
| DE | CF | |||||||||||||||||||||
| D | E | C | F | |||||||||||||||||||
| G | H | IJ | K | |||||||||||||||||||
| I | J | L | M | NO | P | |||||||||||||||||
| N | O | Q | R | |||||||||||||||||||

