Haplogroup J (Y-DNA)
From Ask in Wiki
In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.
Haplogroup J is believed to have arisen 31,700 years ago (plus or minus 12,800 years) in the Near East (Semino et al. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J are descendants of Haplogroup IJ (S2, S22). Haplogroup IJ is in turn derived from Haplogroup F. The main current subgroups J1 and J2, which now account between them for almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.
Contents |
Subdivisions
It is subdivided into two subclades: haplogroup J2, defined by the M172 marker, and haplogroup J1, defined by the M267 marker.
J1
Haplogroup J1 appears at high frequencies among populations of the Middle East, North Africa, and Ethiopia (Thomas et al. 1999). J1 was spread by two temporally distinct migratory episodes, the most recent one probably associated with the diffusion of Muslims from Arabia since the 6th century CE.[1]
Haplogroup J1 is most frequent in Arabs of the southern Levant, i.e. Palestinian Arabs (38.4%) (Semino et al.) and Arab Bedouins (62% and 82% in Negev desert Bedouins). It is also very common among other Arabic-speaking populations, such as those of Algeria (35%), Syria (30%), Iraq (33%), the Sinai Peninsula, and the Arabian Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic countries with mainly non-Arabic countries, such as Turkey and Iran, yet it is found at low frequency among the populations of those countries, as well as in Cyprus and Sicily. It entered Ethiopia in the Neolithic with the Neolithic Revolution and spread of agriculture, where it is found mainly among Semitic speakers (e.g. Amhara 33.3%, but Oromo 3.8%). It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22; Algerians 35.0%, Tunisians 30.1%), where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. 2004). Researchers believe that marker DYS388=17 (Y DNA tests for STR - Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. 2004). Haplogroup J1 is found almost exclusively among modern populations of Southwest Asia, North Africa, and East Africa, essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages. The distribution of J1 outside of the Middle East may be associated with Arabs and Phoenicians who traded and conquered in Sicily, southern Italy, Spain, Azerbaijan, Turkey, and Pakistan, or with Jews, who have historical origins in the Middle East and speak (or historically spoke) a Semitic language, though typically Haplogroup J2 is more than twice as common among Jews. In Jewish populations overall, J1 constitutes 19.0% of the Ashkenazim results and 11.9% of the Sephardic results (Semino et al. 2004)(Behar et al. 2004). Haplogroup J1 with marker DYS388=13 is a distinctive type found in eastern Anatolia (Cinnioglu et al. 2004).
J2
Haplogroup J2 It is composed of several sub-Haplogroups representing several different countries like Turkey, Iraq, Kurdistan, Lebanon, Syria, Armenia, Georgia, Aegean, Balkan, Italy. One sub Haplogroup M172* is mainly found in the Northern Fertile Crescent, the Mediterranean, Iran, Central Asia, and Southern Europe. Is is thought to have originated in Anatolia (Turkey and in the province of Kurdistan) ie North Mesopotamia, and spread to Europe and to other Middle countries like Lebanon Palestine Iraq, Syria. J2 subclades are also found in the South Caucasus (Georgia, Armenia, Azerbaijan), Iran, Central Asia, and South Asia: for example, Muslim Kurds (28.4%), Central Turks (27.9%), Georgians (26.7%), Iraqis (25.2%), Lebanese (25%), Ashkenazi Jews (23.2%), Sephardi Jews (28.6%), Iranians (23.3%), Tajiks (18.4%), and Pakistanis (14.7%). J2 is not regularly found in Semitic-speaking populations of Africa, such as the Amhara and Tigrinya in Ethiopia (Semino et al. 2004). However, J2 has been found to encompass several subhaplogroups (22 subhaplogroups, including 5 that have high frequencies) that originated or expanded in different regions: Italy, the Balkans, the Aegean, Anatolia (Turkey and Kurds), the Caucasus (Georgia), and Somalia (see ref: Semino et al. 2004). Haplogroup J2 was used to be considered a genetic marker of Anatolian Neolithic agriculturalists. It is also very frequent in the Balkans (Greeks 20.6%, Albanians 19.6%) and in southern Italy (16.7-29.1%). Its frequency rapidly drops in the Carpathian basin (Croatians 6.2%, Hungarians 2.0%, Ukrainians 7.3%) and in Southeastern Iranian-speaking areas (Pashtuns 5.2%, Pamiris 6.1%). A significant presence of J2 (J2b2+J2a) was detected in western and south-western India (the highest being 21% among Dravidian middle castes, followed by upper castes, 18.6%, and lower castes 14%; Sengupta et al. 2006).
J*(xJ1,J2)
There are also some haplogroup J Y-chromosomes that belong to neither J1 nor J2, and are said to be in paragroup J*(xJ1,J2). This means that haplogroup J* includes all of J except for J1 and J2. However, Y-chromosomes that belong to paragroup J* are extremely rare among human populations of the present day.
Technical specification of mutation
The technical details of M304 are:
- Nucleotide change: A to C
- Position (base pair): 421
- Total size (base pairs): 527
- Forward 5′→ 3′: caaagtgctgggattacagg
- Reverse 5′→ 3′: cttctagcttcatctgcattgt
Subgroups
The subclades of Haplogroup J with their defining mutation, according to the 2006 ISOGG tree:
- J (12f2.1, M304, S6, S34, S35)
- J*
- J1 (M267)
- J1*
- J1a (M62)
- J1b (M365)
- J1c (M367, M368)
- J1d (M369)
- J1e (M390)
- J2 (M172)
- J2*
- J2a (M410)
- J2a*
- J2a1 (DYS413≤18)
- J2a1*
- J2a1a (M47, M322)
- J2a1b (M67 (S51))
- J2a1b*
- J2a1b1 (M92, M260)
- J2a1b1*
- J2a1b1a (M327)
- J2a1b2 (M163, M166)
- J2a1c (M68)
- J2a1d (M137)
- J2a1e (M158)
- J2a1f (M289)
- J2a1g (M318)
- J2a1h (M319)
- J2a1i (M339)
- J2a1j (M419)
- J2a1k (DYS445≤7)
- J2a2 (M340)
- J2b (M12, M314, M221)
- J2b*
- J2b1 (M102)
- J2b1*
- J2b1a (M241)
- J2b1a*
- J2b1a1 (M99)
- J2b1a2 (M280)
- J2b1a3 (M321)
- J2b1b (M205)
Y-STR Haplotypes
- J Modal Haplotype. Ysearch K23DT
- J1 Modal Haplotype. Ysearch RR9SS
- Ashkenazi Cohen Cluster Ysearch G6839
- J2 Modal Haplotype. Ysearch 9EQTH
- J2a1b1 (M92) Modal Haplotype. (old J2f1) NFNYH
- Comparison
See also
References
- yJdb: the Y-haplogroup J database haplotypes of haplogroup J.
- [2]
- Haplogroup J subclades at International Society of Genetic Genealogy
- O. Semino et al. (2004), Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and Later Migratory Events in the Mediterranean Area American Journal of Human Genetics 74 1023-1034
- F. Di Giacomo et al. (2004), Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe Human Genetics 115 357–371
- Sanghamitra Sengupta et al. (2006), Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists, American Journal of Human Genetics, 78 202-221
- Cinnioglu et al. (2004), Excavating Y-chromosome haplotype strata in Anatolia, Hum Genet (2004) 114 : 127–148, http://evolutsioon.ut.ee/publications/Cinnioglu2004.pdf
External links
| Y-most recent common ancestor | ||||||||||||||||||||||
| | | ||||||||||||||||||||||
| A | BR | |||||||||||||||||||||
| B | CR | |||||||||||||||||||||
| DE | CF | |||||||||||||||||||||
| D | E | C | F | |||||||||||||||||||
| G | H | IJ | K | |||||||||||||||||||
| I | J | L | M | NO | P | |||||||||||||||||
| N | O | Q | R | |||||||||||||||||||
ca:Haplogrup J del cromosoma Y humà fr:Haplogroupe J (Y-ADN) ru:Гаплогруппа J2

